Genetic Correlates of In Vivo Viral Resistance to Indinavir, a Human Immunodeficiency Virus Type 1 Protease Inhibitor

Abstract

Indinavir (IDV) (also called CRIXIVAN, MK-639, or L-735,524) is a potent and selective inhibitor of the human immunodeficiency virus type 1 (HIV-1) protease. During early clinical trials, in which patients initiated therapy with suboptimal dosages of IDV, we monitored the emergence of viral resistance to the inhibitor by genotypic and phenotypic characterization of primary HIV-1 isolates. Development of resistance coincided with variable patterns of multiple substitutions among at least 11 protease amino acid residues. No single substitution was present in all resistant isolates, indicating that resistance evolves through multiple genetic pathways. Despite this complexity, all of 29 resistant isolates tested exhibited alteration of residues M-46 (to I or L) and/or V-82 (to A, F, or T), suggesting that screening of these residues may be useful in predicting the emergence of resistance. We also extended our previous finding that IDV-resistant viral variants exhibit various patterns of cross-resistance to a diverse panel of HIV-1 protease inhibitors. Finally, we noted an association between the number of protease amino acid substitutions and the observed level of IDV resistance. No single substitution or pair of substitutions tested gave rise to measurable viral resistance to IDV. The evolution of this resistance was found to be cumulative, indicating the need for ongoing viral replication in this process. These observations strongly suggest that therapy should be initiated with the most efficacious regimen available, both to suppress viral spread and to inhibit the replication that is required for the evolution of resistance. The human immunodeficiency virus type 1 (HIV-1) protease is a virally encoded aspartyl protease that serves to cleave the Gag-Pol polyprotein precursor into mature proteins. This specific proteolysis occurs late in the viral life cycle and is essential for viral infectivity (24). Several peptidomimetic, competitive inhibitors of this enzyme are being developed as potential anti-viral agents for the control of HIV-1 infection. Among these, indinavir (IDV) (also called CRIXIVAN, MK-639, or L-735, 524) (11, 40), is a potent and selective inhibitor of the enzyme that has recently received accelerated U.S. regulatory approval for HIV therapy. One of the most serious impediments to the successful clinical use of antimicrobial drugs is the emergence of drug-resistant mutants. This has been especially evident for inhibitors of HIV-1 replication. The clinical antiviral effects of the many nu-cleoside and nonnucleoside reverse transcriptase inhibitors have been limited by selection of resistant viral variants. Viruses expressing reduced inhibitor susceptibility have also emerged during cell culture selection with different HIV-1 protease inhibitors, including A-77003, A-80987, ritonavir (ABT-538), BMS 186,318, RPI 312, IDV, saquinavir (Ro 31-8959), VX-478, XM323, and many others (5, 9, 10, 13, 14, 18–20, 23, 25, 32, 38, 39). Predictably, as some of these compounds (IDV, saquinavir, and ritonavir) entered prolonged clinical trials, resistance also developed in vivo (6, 7, 17, 28). The resistance exhibited by one viral isolate selected by IDV was traced to a combination of three amino acid substitutions in the protease (6). However, three other viral isolates evaluated in the same study exhibited such divergent patterns of substitutions in the protease that a simple basis for the resistance could not be defined. In this report, we examine the complex relationship between the ge-notypic and phenotypic changes occurring in the proteases of IDV-resistant viral variants selected in a subset of HIV-1-infected patients treated with the inhibitor. MATERIALS AND METHODS Primary viral isolates. Isolation and phenotypic characterization of primary viral isolates were performed as previously described (33). Phenotypic testing entailed measuring the viral spread in cell culture over serial twofold dilutions of the test drug. Because of the inherent variability of the biological assay, increases in the 95% inhibitory concentration for viral spread in cell culture (CIC 95) of less than fourfold (two dilutions) were not considered indicative of changes in inhib-itor susceptibility. Thus, resistance to IDV was defined as a CIC 95 of 400 nM, fourfold over the typical CIC 95 exhibited by wild-type virus. Molecular analyses. HIV-1 protease genes were amplified and isolated from total RNA of viral cell culture supernatants. RNA isolations and amplifications and cloning and sequencing of protease genes were performed as previously described (6), except that the 5 primer used for the first PCR (gag-RT) was d(CAGAGCCAACAGCCCCACCAG). Briefly, total RNA was reverse transcribed and then amplified in multiple (typically 8 to 12) independent nested PCRs. The product of each PCR was gel purified and separately cloned into plasmid pAMP19 (Gibco-BRL). Only one bacterial colony derived from each